A simple case for intelligent design

[TagliatelliMonster]

Again both the picture that I am “ignoring” and the face of “Jesus” in the pancake are ambiguous and unclear “faces” that loosely resemble something that moreless looks like a human face

So, can't those things be designed like that?
And I disagree, they look very distinctly like faces to me.
The pancake one looks distinctly like Jesus to imo.

See, this might be why people here are asking you for some kind of objective way to determine this "specificity" you keep speaking off. Right now, it seems like no more or less then subjective opinion.

Nevertheles, both appear to me to be unambigously representing human faces. The pancake one a famous person to - which you yourself have said that it increases the amount of "specified complexity".

And surely there is no bias in natural laws to make Jesus his face appear on a pancake.

, while Mt Rushmore resembles clear and unambiguous faces of specific persons.

Just like the pancake

Therefore Mt roshemore is more specified that the other 2 examples, therefore Mt Rushemore is more likely to be designed that any of the other 2 examples.

How much more is it "specified"? In what unit is that expressed?
And what is the threshhold? From which value onwards is "specified complexity" "high enough" to be able to conclude design? And how was that threshhold determined?

There are more possible combinations that would produce an unclear and ambiguous “Jesus” than possible combinatios that would produce a clear and unambiguous “George Washington” whichis why the second is “less specified” this is measurable.

How is that measurable?
What tool do you use to measure this objectively?
In what unit is the "specificity" expressed?
From which "specificity" value onwards can we conclude design?

Granted, Dembkis test can produce false negatives, (something design that fails to pass the test) but it can’t produce false positives (something non design that passed the test)

I disagree.
I've applied the criteria you yourself have mentioned and it lead me to conclude that the jesus face in the pancake must have been designed.

Perhaps the problem is that the very criteria aren't objective, but rather subjective in nature.
Which means you can make it conclude whatever you want to suite your a priori agenda.


But I'll give you the benefit of the doubt and wait for you to answer my questions.

 

[tas8831]

No you don’t have to know a priori if stuff was designed.

Right - you just have to be told if it possesses the hallmarks as put forth by the filter operator of having been designed, since the filter cannot do so on its own.

You are misrepresenting the argument, please try to make an honest effort and try to understand it

I think I am adequately presenting according to how you have depicted it and its various shortcomings.

I note that you have yet to apply it to any aspect of a living thing as an example, rather, you have employed human works of design as analogies.

 

[tas8831]

No that is not true, it is true that you have to know some attributes of “stuff” before apllying the filter, but you don’t have to “know” if it was designed a priori.

But the 'attributes of stuff', according to you,. are the things Dembski claims are hallmarks of design by humans - possession of CSI, 'meaning', etc.

For example random chance can produce a word with meaning, if you type text randomly you might type things like “Dog” or “Cat” everyone in a while. So meaning doesn’t automatically imply design.

But you said re: DNA sequences you need to know the 'meaning' to know whether or not it has CSI.

Seems like semantics to me.

 

[tas8831]

Again both the picture that I am “ignoring” and the face of “Jesus” in the pancake are ambiguous and unclear “faces” that loosely resemble something that moreless looks like a human face , while Mt Rushmore resembles clear and unambiguous faces of specific persons. Therefore Mt roshemore is more specified that the other 2 examples, therefore Mt Rushemore is more likely to be designed that any of the other 2 examples.

What if someone who was not a talented sculptor had set out to make a face of Thomas Jefferson and it ended up looking more like Aaron Burr?

The 'meaning' of the artist was Jefferson, but the 'meaning' as determined by an observer was that it was someone else.

How do you calculate the CSI for that?

 

[tas8831]

As I said before specified complexity can be defined as follows.

Complex : it has many parts or units

Specified: with meaning, function or any
other independent pattern.

Independent : there is not a bias in natural laws towards producing that pattern

To me this definition is clear, unabigous and can be measured.

Ummm....

The "I" in CSI is for "information."

Regarding your definitions:

Complex : it has many parts or units

What constitutes "many"? 3? 20?

Specified: with meaning, function or any other independent pattern.

How is this determined? In the parlance of ID, "specified" refers to 'ahead of time', i.e., it was planned (aka designed). More circular reasoning?

 

[tas8831]

The Design hypothesis becomes more and more probable as the level of specificity increases. (assuming a constant level of complexity)

It is measurable, all you have to do is determine all the possible combinations of patterns allowed by the laws of nature, then compare it with all the possible combinations that would produce the desired pattern (or something equivalent) … then you will get a number (a probability) so all you have to do is compare that probability with your probabilistic resources,

If this is so, then why could you not tell me more about the DNA sequence I presented for you earlier, if all you have to do is determine all the possible combinations of patterns allowed by the laws of nature, then compare it with all the possible combinations that would produce the desired pattern (or something equivalent).


Seems like Dembski acolytes are far far more adept at talking up and talking about the filter than actually employing it.

And you must have missed this by accident:


How many mutations would it have taken to get a human pelvis (left) from an Australopithecine pelvis (right)?

Show your work please.

I was once told by a creationist computer tech that it must be 1 million! He could not explain why, he just "knew" it.
And yet... We actually know that a single mutation can produce this kind of pelvis:

via normal phenotypic parents.

 

[leroy]

Truthfully, i am not sure. If the alien is different enough from us, it may not recognize the formation as anything other than natural. The only thing giving it away is the smoothness, as far as i can see. And in a million years, that will go away, even if the faces are still visible.



But there are few combinations that would give *that specific rock face*. So, we could say that specific rock face is specified, right?

So what's so important about it being the face of a human, as opposed to that specific structure for the rocks?



But you haven't described how to determine specificity. You point to an ambiguous face in a rock and say it is similar to some human face. But it is *exactly* like that specific face in the rock. So why is it not specified?

And that is the underlying problem with your 'specificity' criterion: everything is ultimately unique and so a good enough description of it will have very high specificity.



And no matter what the pattern is, the number of combination that would produce that exact pattern is *one*. It is extremely specified.

The issue is how you determine whether two different combinations are *equivalent*. There is no way to accurately measure that.



So? It is also incredibly unlikely that the specific face we see in the rock (or, for that matter, any other specific formation) would be produced. You claim it is an ambiguous human face and I claim it is a completely unambiguous rock face.

At some point, you have to specific *ahead of time* what the criteria are for your 'specificity'. You don't get to look at the data and *then* say it fits something you just made up. That is known as data mining and is an invalid way to proceed.

...relevant quote

So? It is also incredibly unlikely that the specific face we see in the rock (or, for that matter, any other specific formation)

In fact Richard Dawkins provides a detailed explanation on why the moon, a mountain or a junkyard is “simple” and a watch a dog or an airplane is “complex” even though a specific junk yard might be as unlikely as an airplane.

The book is free and you can start reading from this sentence…

So, what is a complex thing? How should we recognize it? In what://terebess.hu/keletkultinfo/The_Blind_Watchmaker.pdf

What Dawkins calls “complex” corresponds to what I am calling “specified”
But the simple answer would be that Mount Rushmore has an objective pattern, the faces objectively happen to be similar to those of the presidents. (please read from the blind watch maker for a more detailed and complete explanation)

At some point, you have to specific *ahead of time* what the criteria are for your 'specificity'

Yes that is true, but I don’t see why is this a problem, sure I have to know ahead of time how human faces look like before proclaiming “specificity”

And in the context of Biology, sure I have to know ahead of time that a series of bases (a gene) has a function before proclaiming specificity,…. but so what? I don’t see the problem

 

[leroy]

Ummm....

The "I" in CSI is for "information."

Regarding your definitions:

Complex : it has many parts or units

What constitutes "many"? 3? 20?

Specified: with meaning, function or any other independent pattern.

How is this determined? In the parlance of ID, "specified" refers to 'ahead of time', i.e., it was planned (aka designed). More circular reasoning?

No, specified doesn’t mean “planed” as I said before the word “dog” is specified, but it can be created by typing random letters, without a plan and without a designer,

Something can be specified but not designed.

please make an honest effort and try to understand the concept, you sound like YECs who say “if we evolved from monkeys why are there still monkeys”

With many (in complex) you have to take in to account your probabilistic resources, “many” would be just a number that is just too big to be accounted by “chance” considering your probabilistic resources.

 

[leroy]

If this is so, then why could you not tell me more about the DNA sequence I presented for you earlier, if all you have to do is determine all the possible combinations of patterns allowed by the laws of nature, then compare it with all the possible combinations that would produce the desired pattern (or something equivalent).


Seems like Dembski acolytes are far far more adept at talking up and talking about the filter than actually employing it.

And you must have missed this by accident:


How many mutations would it have taken to get a human pelvis (left) from an Australopithecine pelvis (right)?

Show your work please.

I was once told by a creationist computer tech that it must be 1 million! He could not explain why, he just "knew" it.
And yet... We actually know that a single mutation can produce this kind of pelvis:

via normal phenotypic parents.

Why are you insisting in the pelvis example? Wh yis that relevant to the conversation? I have no idea how many mutations are required, and I don’t understand why am I suppose to answer that question…..you are the one who asserts that pelvises evolved by random mutations, so if anything you are the one who is suppose to answer to that question.

As I said before, I personally can’t read DNA letters, therefore I personally cant tell if that represents a functional gene, therefore I cant tell if it is specified

 

[leroy]

Well, we have seen a self-replicator with about 120 RNA bases.



Highly Efficient Self-Replicating RNA Enzymes

Of course, the term 'self-replicator' will depend on environment, but here is an example of self-replicating RNA.



See above link.

The claim is not that self replicating enzymes cant exist, the claim is that such enzymes cant be created by natural mechanism (without preexisting life) because these enzymes would have the attribute of specified complexity,

 

[leroy]

Well, we have seen a self-replicator with about 120 RNA bases.



Highly Efficient Self-Replicating RNA Enzymes

Of course, the term 'self-replicator' will depend on environment, but here is an example of self-replicating RNA.



See above link.

Can you quote the part of the article where it says that the enzynme has 120 bases?

 

[leroy]

So, can't those things be designed like that?

Yes they can be designed, but chance can also produce an ambiguous “Jesus” … but it would be very, very unlikely for chance to create clear and unambiguous faces of presidents, like those in Mt Rushmore. So chance can account for ambiguous faces of “Jesus” but chance cant account for clear and unambiguous faces of presidents …….. agree yes or no? (let me guess, you will not answer to this question)

And I disagree, they look very distinctly like faces to me.

But the faces of Mt Rushmore are far clearer than those in toast agree?

See, this might be why people here are asking you for some kind of objective way to determine this "specificity" you keep speaking off. Right now, it seems like no more or less then subjective opinion.

It is not a subjective opinion; it is an objective fact that there are more possible combinations that would end up looking like an ambiguous “Jesus” than possible combinations that would create a clear and unambiguous George Washington.

How much more is it "specified"? In what unit is that expressed?
And what is the threshhold? From which value onwards is "specified complexity" "high enough" to be able to conclude design? And how was that threshhold determined?

You have to consider your probabilistic resources, it’s a probability argument, you never conclude with 100% certainty that something was design, all you can do is conclude that design is more plausible than chance, …. Chance will become less and less likely as the degree of specificity increases. For example your Jesus is probably a result of chance, but if it would have been a symmetrical Jesus, with ears, eyelashes, teeth etc. it would have been more specified an dchance would become less and less likely as you add these kind of details.

How is that measurable?
What tool do you use to measure this objectively?
In what unit is the "specificity" expressed?
From which "specificity" value onwards can we conclude design?

In order to measure it you have to consider all the possible combinations vs the specific combinations that would produce the desired pattern or something equivalent.

If you what to talk about text, meaning in some language would be an example of a pattern, ie how many possible combinations of text vs how many combinations that would produce meaningful words and sentences.

If you want to talk about DNA, how many possible combinations of bases can you have vs how many possible combinations would produce something that codes for a function.

If you what to tal about Proteins, how many possible combinations of aminoacids can you have vs how many combinations would produce a functional protein.

If you what to talk about rocks, how many possible combinations can you have vs. all the possible combinations that would produce a clear and unambiguous face (or something equivalent)

 

[leroy]

Right - you just have to be told if it possesses the hallmarks as put forth by the filter operator of having been designed, since the filter cannot do so on its own.
.

Yes that is true, but I don’t see why that is a problem. The claim is that if “stuff” has “X” and “Y” hallmarks you can infer design. If you don’t know what if it possess the hallmarks then you can’t apply the test. And the claim is falsifiable; you can show that something is “non-design” despite having the hallmarks.

Again I don’t see why is that a problem

 

[Polymath257]

Can you quote the part of the article where it says that the enzynme has 120 bases?

1. It isn't an enzyme. It is a ribozyme. Enzymes are protein. Ribozymes are RNA.

2. Figure 3 shows the ribozyme. You can count the bases. For convenience, they are numbered on the lower strand.

3. Here is another link to the paper: Highly Efficient Self-Replicating RNA Enzymes - ScienceDirect

4. There were also examples in the paper of cross-replicating strands: two sequences, each catalyzing the formation of the other.

 

[TagliatelliMonster]

How do you calculate the CSI for that?

"calculate". lol.

You're a funny guy, you.

 

[TagliatelliMonster]

Tthese enzymes would have the attribute of specified complexity,

How was that determined?

 

[TagliatelliMonster]

Yes they can be designed, but chance can also produce an ambiguous “Jesus” … but it would be very, very unlikely for chance to create clear and unambiguous faces of presidents, like those in Mt Rushmore.

I'ld even say that it is impossible for natural forces to make the sculptures in mt rushmore.
My question to you is: how do we know that?

It is not a subjective opinion

It is. So far, this is no more or less then "my opinion is that it looks like person X".

You even implied that if mr rushmore were faces of random unknown people, or not even existing people, that the "specificity" would go down. Thus making it less likely to be designed.

I utterly disagree. But off course, I don't conclude artificial design from a framework of subjective opinion with this "specificity" nonsense.

But we'll get there... First answer my question above: how do we know that it's as good as impossible that natural forces won't be resulting in mt rushmore?

You have to consider your probabilistic resources, it’s a probability argument, you never conclude with 100% certainty that something was design, all you can do is conclude that design is more plausible than chance, …. Chance will become less and less likely as the degree of specificity increases. For example your Jesus is probably a result of chance, but if it would have been a symmetrical Jesus, with ears, eyelashes, teeth etc. it would have been more specified an dchance would become less and less likely as you add these kind of details.

You're not answering my questions.
You're just repeating the vagueness instead.

If you can't put a value on this "specificity" thingy, which should be able to be determined through an unambigous method based on the properties of the thing you are measuring, then it has no objective merrit. Then we are back to the subjective opinion of "i think it looks like X".

If you want to talk about DNA, how many possible combinations of bases can you have vs how many possible combinations would produce something that codes for a function.

The various functions of DNA are well explained through evolution theory.

If you what to talk about rocks, how many possible combinations can you have vs. all the possible combinations that would produce a clear and unambiguous face (or something equivalent)

You mean, that we would recognise as such...

In any case, the amount of "possible combinations" is huge off course. But there's also plenty of combinations that are ruled out. Like the "combinations" in mr rushmore.

My question, to repeat, at this point is: how do we know that?

 

[Subduction Zone]

How was that determined?

He used quantum tensor hand waving. Very advanced stuff.

 

[tas8831]

No, specified doesn’t mean “planed” as I said before the word “dog” is specified, but it can be created by typing random letters, without a plan and without a designer,

So then specification is NOT a criterion for having been designed, got it.

Something can be specified but not designed.

Specified after the fact, then.
So if something can be specified after the fact, 'specified' doesn't seem to have much relevance to the filter.

please make an honest effort and try to understand the concept, you sound like YECs who say “if we evolved from monkeys why are there still monkeys”

Funny projection. You sound like the creationists that think ReMine's arguments have merit.

With many (in complex) you have to take in to account your probabilistic resources, “many” would be just a number that is just too big to be accounted by “chance” considering your probabilistic resources.

And how do you determine what the probabilistic resources are?

Show your work with a relevant example.

What are the probabilistic resources for this DNA sequence:

ATGACAAACATTCGAAAAACACACCCCTTACTTAAAATTGTCAACCATGCATTTATTGACCTACCAGCTC

 

[tas8831]

Why are you insisting in the pelvis example?

Because it shows how the creationists hawking 'not enough mutations' really have no argument.

Wh yis that relevant to the conversation? I have no idea how many mutations are required, and I don’t understand why am I suppose to answer that question…

You have presented ReMine's 'not enough mutations' argument, have you not?
Well, here is your chance to shine.

..you are the one who asserts that pelvises evolved by random mutations, so if anything you are the one who is suppose to answer to that question.

Cool burden shift.
I have no idea.
But I am NOT the one claiming that Haldane's model does not allow for enough, am I?

In order to have a foundation for your claim of 'not enough', does it not stand to reason that you should be able to say 'how many are needed'?

As I said before, I personally can’t read DNA letters, therefore I personally cant tell if that represents a functional gene, therefore I cant tell if it is specified

Ah, so the filter is useless.

We've known that for some time. Weird that Dembski and his acolytes can't seem to figger' it out.

Well, actually I am sure Dembski has - he just liked taking the money of the rubes.

I note that you have yet to apply it to any aspect of a living thing as an example, rather, you have employed human works of design as analogies.