Dell
Asteroid insurance?
Another step to creating life or something like it... hopefully it will not develop a taste for humans...
Scientists Create Living, Eating, Growing Machines
Scientists Create Living, Eating, Growing Machines
-
Welcome to Religious Forums, a friendly forum to discuss all religions in a friendly surrounding.
Your voice is missing! You will need to register to get access to the following site features:- Reply to discussions and create your own threads.
- Our modern chat room. No add-ons or extensions required, just login and start chatting!
- Access to private conversations with other members.
We hope to see you as a part of our community soon!
Scientists create living eating and growing machines...
- Thread starter Dell
- Start date
Its probably toxic and made up of rare metals.
A science news article that forgets to refer to the actual published paper is very irritating.
Yippee!
Subduction Zone
Veteran Member
I took this as a challenge:
Dynamic DNA material with emergent locomotion behavior powered by artificial metabolism
Jollybear
Hey
This proves that it takes intelligence to create or design life.
No it doesn't. At best it "proves" that intelligence could create or design life.
The leaps you Discovery pawns make are sometimes grossly hilarious.
Jollybear
Hey
Well that still tips it toward evidence of intelligence more so then none intelligence creating life, lol
No it doesn't. At the VERY best it makes the old Creationist argument "well, you can't create life from non-life!" even more nonsensical than it always was. I.E It's implying *humans* CAN create life in the lab.
Let it sink in. Humans creating life in a lab. That's all it "proves." And even then i'd say it's not conclusive yet. A good start.
Oh and even better: It blurs the line between robotics and biology. They might end up being one and the same in the future.
Living-eating-and-growing-humans gave birth to those scientists.
Jollybear
Hey
Your simply making excuses.
If scientists made life in the lab, then it proves that intelligence can create life.
Its simple.
You're projecting.
Yes, but it doesn't prove your chosen intelligence actually exists. It ONLY proves that HUMANS can create life in a lab. Nothing else. You're employing wishful thinking.
Too complex for you.
Jollybear
Hey
No, your denying.
Proving and evidence are different. Its evidence that intelligence creates life.
Too logical for you.
Bob the Unbeliever
Well-Known Member
Indeed .... ONLY intelligence can create life ....
binary code (10010010110101101001001010101) .... or
Genetic code in DNA (aggcgtcagtcataacagtcgtcagtcatcacagtcgtcagtgataac - upto 4 billion per cell)
Oh.... dear. Such a collection of deliberate and maliciously misleading material I have not seen in months.
I suppose if the Lie is for Jesus, then it's okay? And not, in fact, False Witness?
I am denying your accusation and making a counter claim that it is you who is giving excuses. As in, you're projecting.
There's some evidence that intelligence can create life. You're the one that said it *proves* your particular chosen intelligence. I'm saying your version is not proven.
Let's pretend your wishful thinking corresponds to reality.