prove me wrong on evolution

[JerryL]

Do you agree that you could very well be describing a human being in what you wrote above? I hope you would say 'yes' because all of the above can happen to a human.

"could very well be"? I am describing the differences between a chimp and a human, in the same manner you are describing the differences between other animals, and pointing out that none of those changes would be a "new feature" under your definition.

According to how you've defined "macroevolution", a chimp evoloving into a person would be "microevolution".

i mean at the scientific level do they merely look at the physical makeup (phenotype) of the creature and compare it with another creature, or is there another thing they use to look at the differences between creatures and why?

Actually, we like to look at the DNA strands. In sexually-reproducing creatures, we are particularly fond of midocondrial DNA. We used to evaluate by morphology, but genetic mapping is more accurate.

But while you started by talking about the genome, you then became obsessed with "new features" and discussed them from a morpological level.

 

[Endless]

in the same manner you are describing the differences between other animals, and pointing out that none of those changes would be a "new feature" under your definition.

Quite true, they are not new features, simply variations of existing features, however before you jump on the bandwagon and hurtle down the hill, i would like to point out that it is only at the genetic level that the true difference between creatures can be seen because on the outside we only see the outside, at the genetic level we see everything.
Evolution occurs at the genetic level.

But while you started by talking about the genome, you then became obsessed with "new features" and discussed them from a morpological level.

If a fly was to evolve into a wasp then it needs 'new features' ie. the sting. This needs new genetic information which cannot come from just shuffling and duplication of existing genetic material in the fly - because the fly has no genes encoding all the things it needs for a sting. This is an example irrespective of whether a fly did evolve into a wasp - if creatures evolved from simplistic organisms then we need new genetic information being provided from somewhere - recombination of existing genes will get the organism to evolve within a restricted limit - unless new genetic information is produced the organism will remain within that limit.
Now evolution within this limit is termed 'microevolution' the processes like duplication, recombination will get it so far but then no further. Think of it like you'll only ever get a certain number of combinations.

So do you acknowledge that because the creature is limited in this sense could not evolve into the next creature on the evolutionary ladder. If you still think this is a load of rubbish then you must show me how there is no restrictive limit KEEPING in mind that i am only talking about duplication and recombination at this stage.

 

[JerryL]

Quite true, they are not new features, simply variations of existing features, however before you jump on the bandwagon and hurtle down the hill, i would like to point out that it is only at the genetic level that the true difference between creatures can be seen because on the outside we only see the outside, at the genetic level we see everything.
Evolution occurs at the genetic level.

Then I would suggest you stop discussing features and protiens and discuss base-pairs.

If a fly was to evolve into a wasp then it needs 'new features' ie. the sting.

And back into morphology.

This needs new genetic information which cannot come from just shuffling and duplication of existing genetic material in the fly - because the fly has no genes encoding all the things it needs for a sting.

Which gene encodes for a stinger?

recombination of existing genes will get the organism to evolve within a restricted limit - unless new genetic information is produced the organism will remain within that limit.

Old DNA string GATTACCTCA
Duplication occurs: GATTACCTCAGATTACCTCA
Transposition mutation occurs GATTACCTCAGAACTTCTCA

Look, "new information" at a genetic level

Or, with English
DOG
DOGDOG
DOGGOD

So do you acknowledge that because the creature is limited in this sense could not evolve into the next creature on the evolutionary ladder. If you still think this is a load of rubbish then you must show me how there is no restrictive limit KEEPING in mind that i am only talking about duplication and recombination at this stage.

no, I really don't. In asking for a negative prrof you are making an argument from ignorance. If you wish to make the positive claim that a limiting factor exists; you carry the burden of proof.

 

[Endless]

Ok Jerry, i'm going to keep this really really simple for you.

Could evolution occur from that first simple life form that existed on this earth to all the other life forms we have today without mutation? Explain your answer.

 

[JerryL]

Ok Jerry, i'm going to keep this really really simple for you.

Could evolution occur from that first simple life form that existed on this earth to all the other life forms we have today without mutation? Explain your answer.

No. The theiry of evolution has mutation as it's only method of genome change.

 

[Endless]

Ok, nice one, now we are getting somewhere. Do you know why?

 

[JerryL]

Ok, nice one, now we are getting somewhere. Do you know why?

I don't think that's really a "why"able question: like "why do insects have 6 legs".

 

[Endless]

Creatures can evolve without mutation, but as a result it will not lead to evolution from that first simple life form that existed on this earth to all the other life forms we have today without mutation. Like recombination - that is not mutation, yet it will lead to shorter legs, less hair, smaller jawbone etc just like the things you described when talking about the chimp. This is what i meant when i said the creature evolves within a restricted limit. But recombination although it can cause these changes is not enough to evolve that first simple life form that existed on this earth to all the other life forms we have today - because like you said, evolution requires mutation.
The reason why mutation is needed to evolve that first simple life form that existed on this earth to all the other life forms we have today is because mutation can add and cause new codes of DNA which can code for new structures. This is how the fly could get a sting in my previous example. So by continually getting new codes the simple organism begins to become more complex and begins to change and have new structures that it did not already have - like a sting.

It's important to understand that everything i have told you above is not a creationist arguement - it's science and you can check it on any biological site on the internet if you want. I haven't even started to make a creationist arguement I have to give you all the facts first before i can show you why we see microevolution and macroevolution. What i am providing you with are the scientific facts regarding how creatures evolve.

 

[Fade]

Creatures can evolve without mutation, but as a result it will not lead to evolution from that first simple life form that existed on this earth to all the other life forms we have today without mutation. Like recombination - that is not mutation, yet it will lead to shorter legs, less hair, smaller jawbone etc just like the things you described when talking about the chimp.

I have a sneaky suspicion that you are making this up as you go along.
"Recombination - that is not mutation?" The who the what now? If an organism has shorter legs and less hair than the rest of what is considered its species surely then that organism is in fact a mutant? Think of Dwarfs and Giants in the human world. And, oh wait a minute, you do know that you are a mutant don't you?

This is what i meant when i said the creature evolves within a restricted limit. But recombination although it can cause these changes is not enough to evolve that first simple life form that existed on this earth to all the other life forms we have today - because like you said, evolution requires mutation.

Yes, that is what evolution is. The only 'restricted limit' on evolution is 'survival'. If the mutation works and the organism is able to survive it has a much better chance of passing the mutation on.

It's important to understand that everything i have told you above is not a creationist arguement - it's science and you can check it on any biological site on the internet if you want. I haven't even started to make a creationist arguement I have to give you all the facts first before i can show you why we see microevolution and macroevolution. What i am providing you with are the scientific facts regarding how creatures evolve.

If it is science please can you provide me with a peer reviewed source?

 

[Endless]

Fade,
I'm providing a few links to explain the very basic scientific principles on which evolution opertates.

Recombination (natural selection and recombination are at the root of genetic drift - see website) is what happens when a couple have a child together - it's the natural reshuffling of DNA whereby the child gets a mixture of the Father's DNA and the mother's DNA. This is not mutation.
I'll provide the secular links for you to read up on, but there really is no point in continuing since i'm having to explain the mechanism by which a creature can evolve (change) and you are arguing with them. Like i said, these are just what science teaches. Read through these links and go back and read what i wrote before, hopefully what i wrote will then make a whole lot more sense to you.
If you want get a friend who you know is a scientist or knows a whole lot about evolution and ask them or invite them to this topic. Get them to explain it to you.

Here you can read up 'how evolution happens' please pay particular attention to the section How does evolution occur?
Here you can read up on recombination
Here you can read up on mutation
Here you can read an interview on natural selection

These should provide you with the basis

 

[Fade]

What is the difference between macroevolution and microevolution? From the perspective of evolutionary biology, macroevolution is nothing more than a lot of microevolution occurring over time, which leads to new species.

From the first link you provided. This is exactly what I have been saying. Thank you for making our point for us.

 

[Fade]

I'll provide the secular links for you to read up on, but there really is no point in continuing since i'm having to explain the mechanism by which a creature can evolve (change) and you are arguing with them.

No point continuing since you don't have a point.

Like i said, these are just what science teaches. Read through these links and go back and read what i wrote before, hopefully what i wrote will then make a whole lot more sense to you.

Nope, what you said still doesn't make sense.

If you want get a friend who you know is a scientist or knows a whole lot about evolution and ask them or invite them to this topic. Get them to explain it to you.

How wonderfully patronising. Thanks, but I think I know enough to know that it is you who needs a scientist to explain evolution to them.

 

[Endless]

Yet you have not even understood the very basic principles of evolution - how are you even going to be able to attempt to decide for yourself whether there is a difference between microevolution and macroevolution?
When you come back and say that you do now understand the basic principles of evolution i will show you why what creationists define as microevolution could never over time give rise to macroevolution.

Hey, don't forget it was you that didn't know there was a difference between recombination and mutation I do know my stuff and i can guarrentee that i have been educated in evolutionary theory to a far higher level than you have.

 

[Fade]

Yet you have not even understood the very basic principles of evolution - how are you even going to be able to attempt to decide for yourself whether there is a difference between microevolution and macroevolution?
When you come back and say that you do now understand the basic principles of evolution i will show you why what creationists define as microevolution could never over time give rise to macroevolution.

What creationists define as microevolution is irelevant to the discussion at hand and has nothing to do with science.
The distinction between macro/micro is a fabrication of creationism/ID.

 

[Endless]

What creationists define as microevolution is irelevant to the discussion at hand and has nothing to do with science.
The distinction between macro/micro is a fabrication of creationism/ID.

Yes, at the present time it is totally irrelevant because we are not even discussing it - we are just discussing the basic principles of evolution :banghead3 . It's what i've been saying all along, i haven't even begun to enter into that. I'm merely trying to lay the foundations of scientific facts. Which you have been arguing against...

In anycase you could not possibly make the distinction at the present time between microevolution and macroevolution even if you wanted to, because you still do not know the basic principles by which evolution operates.

 

[Fade]

I'm sorry, which part of what I have said in this thread runs counter to what science defines as 'Evolution'? Please point out my error to me.

Where have I been arguing againts scientific facts?

I can't make a distinction between micro/macro because there is none.

 

[Endless]

I wrote:

Creatures can evolve without mutation, but as a result it will not lead to evolution from that first simple life form that existed on this earth to all the other life forms we have today without mutation. Like recombination - that is not mutation, yet it will lead to shorter legs, less hair, smaller jawbone etc just like the things you described when talking about the chimp.

You wrote:

I have a sneaky suspicion that you are making this up as you go along.
"Recombination - that is not mutation?" The who the what now? If an organism has shorter legs and less hair than the rest of what is considered its species surely then that organism is in fact a mutant? Think of Dwarfs and Giants in the human world. And, oh wait a minute, you do know that you are a mutant don't you?

You hadn't a clue what recombination was did you? You also obviously didn't have a clue what a mutation actually was. You also thought that recombination was a mutation...I mean come on, these are basic evolutionary principles that you don't understand or know about. That was the reason i posted up the links..i'm trying to help you here.

I can't make a distinction between micro/macro because there is none.

No, you couldn't even make the distinction if you wanted to - you don't have enough knowledge of what exactly causes evolution and the different types of evolutionary mechanisms to be able to know whether there is a distinction or whether there isn't. Hence the reason i'm trying to help you.

 

[Fade]

You hadn't a clue what recombination was did you? You also obviously didn't have a clue what a mutation actually was. You also thought that recombination was a mutation...I mean come on, these are basic evolutionary principles that you don't understand or know about. That was the reason i posted up the links..i'm trying to help you here.

Yes, I didn't have a clue. Fairly obvious considering my answer "the who the what now?' or is reading comprehension something you have trouble with? However I'll say it again, you do know that you are a mutant don't you? Every organism is, you do know this don't you?

No, you couldn't even make the distinction if you wanted to - you don't have enough knowledge of what exactly causes evolution and the different types of evolutionary mechanisms to be able to know whether there is a distinction or whether there isn't. Hence the reason i'm trying to help you.

There is no distinction other than time. You can make up any definition you like but the simple fact is that you are wrong. Help me to help you ... help me... to help you ...

 

[Endless]

Yes Fade, i am well aware that every person is a mutant. But not because of recombination.

If an organism has shorter legs and less hair than the rest of what is considered its species surely then that organism is in fact a mutant?

Umm, no. Recombination acted on by natural selection can give rise to this - mutation doesn't even have to happen...

 

[Fade]

Yes Fade, i am well aware that every person is a mutant. But not because of recombination.

Well that's settled then, I wasn't trying to imply that it was. My apologies if that is what came accross in my reply.

Umm, no. Recombination acted on by natural selection can give rise to this - mutation doesn't even have to happen...

okay, so what is your point?