Why the Cosmological Argument Fails

[Thermos aquaticus]

I would say, and you would say, that abiogenesis is far more complex (on the order of 1*10^500 complex) than snowflakes or a stable heat bath in an open system.

I would ask your response if we found extraterrestrial life who came to Earth to tell us they are in touch with the Creator?

Here is a quote I saw last week on abiogenesis. I trust you to have some good responses to get me to think more if I misunderstand it:

Over the past sixty years, dedicated and skillful scientists have devoted much effort and ink to the origin of life, with remarkably little to show for it.

[Quoting Radu Popa, 2004,] "So far, no theory, no approach, no set of formulas, and no blackboard scheme has been found satisfactory in explaining the origin of life." At the conclusion of a century of science, whose great glory is the discovery of how living things work, there is something downright disgraceful about this confession, an intimation that despite our vast knowledge and clever technology there may be questions that exceed our grasp. But its truth is indisputable. A survey of the literature devoted to the beginnings of life leaves one in no doubt that all the critical questions remain open.

For the present, we are in limbo. The natural path from simple cosmic molecules to cells, from chemistry to biology, remains undiscovered. …where we should look for illumination I cannot say.

The difference between a puzzle and a mystery is that the former can be solved within the framework of known principles, while the latter cannot. In the end, the origin of life remains a mystery that passes understanding. …we may still be missing some essential insight.

Scientists' refusal to grant some space to the mind and will of God may strike the majority of mankind as arbitrary and narrow-minded, but it is essential if the origin of life is to remain within the domain of science. A nudge from the divine would help us clear some very high hurdles; but once that possibility is admitted there will be no place to stop, and soon the settled principle of evolution by natural selection would be thrown into doubt.

Life's origin has been most ardently pursued by chemists, apparently on the unspoken premise that once the molecular building blocks are on hand, cellular organization will take care of itself. That premise is surely incorrect. Modern cells do not assemble themselves from preformed constituents, and they would not have done so in the past.

…the notion that the first protocells assembled themselves spontaneously from a generous menu of precursor molecules conveniently supplied by abiotic chemistry (or imported by way of comets and meteorites) is now widely recognized as simplistic and effectively has been abandoned. Among its most cogent critics are experienced masters of the art of prebiotic synthesis, who are well aware of the shortcomings of many of the proposed routes and of the wide gap between the range of molecules that living things employ and those that can be made in the laboratory.

…the fact is that chemists have encountered insuperable difficulties in generating a working replicator, and many have expressed doubts about the project. It is at least incumbent upon proponents of its spontaneous genesis to explain how the "correct" monomers could have been selected from the "prebiotic clutter," how a sufficient concentration of monomers was maintained, where the energy came from, and how the replicator evaded the tendency of polymers to break down by hydrolysis.

A decade ago, a hot topic for debate was which came first, replication or metabolism? That issue has not been resolved but has been largely superseded by the recognition that neither of them, by itself, can take one far along the road to life. It is simply not credible to claim that anything beyond the most rudimentary kind of replication or metabolism could have arisen in free solution.

In truth, there is presently no persuasive hypothesis to account for the emergence of protocells from the primal chaos.

The crucial step in the transfiguration of protocells into true cells will have been the invention of translation and the genetic code. …the origin of the principles that govern cellular operations today - genes specifying proteins and all the apparatus that this requires - remains quite unknown and points beyond the capacity of present-day biochemistry and biophysics.

So all you have is just one big argument from ignorance?

 

[Thermos aquaticus]

Are you saying things like abiogenesis and changes between animal kinds via mechanistic evolution are on the order of 1:150 million or FAR larger numbers? Are you saying that 150 million open systems were hit by vulcanism, solar energy, etc. to make that one wonderful pool of life?

There are billions of planets in each galaxy and there are billions of galaxies. If the odds are 1 in 150 million, then there are thousands or even millions of planets out there with life.

 

[It Aint Necessarily So]

I would say, and you would say, that abiogenesis is far more complex (on the order of 1*10^500 complex) than snowflakes or a stable heat bath in an open system.

Did you mean that cells are complex?

Complexity per se does not require intelligence to form it. The intelligent design people agree, which is why they search for irreducible and specific complexity.

I would ask your response if we found extraterrestrial life who came to Earth to tell us they are in touch with the Creator?

I'd be interested.

How about you? What if it wasn't the creator or creators that you were expecting? What if it were the Viking pantheon? Would you worship them?

Over the past sixty years, dedicated and skillful scientists have devoted much effort and ink to the origin of life, with remarkably little to show for it.

That is incorrect. The progress has been significant. What is being constructed is a chain from simple organic molecules to living replicators, Many links have been identifies, but the connection is still incomplete, hence no chain yet.

"So far, no theory, no approach, no set of formulas, and no blackboard scheme has been found satisfactory in explaining the origin of life." At the conclusion of a century of science, whose great glory is the discovery of how living things work, there is something downright disgraceful about this confession, an intimation that despite our vast knowledge and clever technology there may be questions that exceed our grasp

Disgraceful? No.

And yes, this enterprise may be beyond our grasp. We may never solve this problem. If so, we will live with that.

But there is no reason to think that now. We've been making steady progress decade after decade. Don't you think that we should have a very long stagnant period with no further progress before beginning to think that this problem is unsolvable?

Scientists' refusal to grant some space to the mind and will of God may strike the majority of mankind as arbitrary and narrow-minded, but it is essential if the origin of life is to remain within the domain of science.

There is nothing arbitrary or narrow-minded about rational skepticism, which rejects insufficiently supported claims such as god claims.

If you'd like to see the effect of throwing gods into your inquiries about physical reality, look to the ID people and the lack of benefit that move had for them. Throwing a god into abiogenesis research would be just as unhelpful.

What value would it be to do that here? None.

the notion that the first protocells assembled themselves spontaneously from a generous menu of precursor molecules conveniently supplied by abiotic chemistry (or imported by way of comets and meteorites) is now widely recognized as simplistic and effectively has been abandoned.

No, it hasn't been abandoned. If it were, abiogenesis research would be abandoned.

Astrology has been abandoned.

I frequently ask creationist this question,and seldom get an answer, and never a good one: What do you propose that the scientists do? Just quit looking for the answers and accept a creationist position? Yes or no should appear somewhere in your answer.

 

[BilliardsBall]

We don't know what that cell looked like which makes it a bit difficult to calculate probabilities with respect to that first life coming about through natural means.

I call baloney.

 

[BilliardsBall]

First, mutations aren't rare at all. All of us are born with 50 to 100 mutations. This is known from sequencing the genomes of two parents and their offspring.

With that in mind, let's see how many mutations have occurred in the human lineage. Let's go with the lower end of the range for mutation rate at 50 mutations per person, a generation time of 25 years, 5 million years since splitting from the chimp lineage, and a constant population of just 100,000 humans which is on the lower end.

So that's 50*100,000 = 5,000,000 mutations per generation. In 5 million years there are 5,000,000/25 = 200,000 generations. That's 5E6 mutations multiplied by 2E5 generations for 1E12 or 1 trillion mutations that occurred in the human lineage. We are separated from chimps by 40 million mutations, about half of which (20 million mutations) would have occurred in our lineage. 20 million mutations is just 0.002% of the total number of mutations that occurred in the human lineage. This means that just 2 out of every 100,000 mutations that did occur made it to the current population. Of course, this number will change a bit when we add in more human variation from more sequencing, but I think you get the picture.

So I don't see how 40 million mutations separating humans and chimps is a problem. We only kept a handful of mutations out of every 100,000 that did occur, and the vast majority of those are going to be neutral mutations that happen in junk DNA. As these numbers show, beneficial mutations don't have to be that common in order to produce the change we see in species.

"We see"? Which present tense change might I be observing today, please?

 

[BilliardsBall]

There are billions of planets in each galaxy and there are billions of galaxies. If the odds are 1 in 150 million, then there are thousands or even millions of planets out there with life.

Someone hasn't heard of Fermi's Paradox.

 

[BilliardsBall]

Did you mean that cells are complex?

Complexity per se does not require intelligence to form it. The intelligent design people agree, which is why they search for irreducible and specific complexity.



I'd be interested.

How about you? What if it wasn't the creator or creators that you were expecting? What if it were the Viking pantheon? Would you worship them?



That is incorrect. The progress has been significant. What is being constructed is a chain from simple organic molecules to living replicators, Many links have been identifies, but the connection is still incomplete, hence no chain yet.



Disgraceful? No.

And yes, this enterprise may be beyond our grasp. We may never solve this problem. If so, we will live with that.

But there is no reason to think that now. We've been making steady progress decade after decade. Don't you think that we should have a very long stagnant period with no further progress before beginning to think that this problem is unsolvable?



There is nothing arbitrary or narrow-minded about rational skepticism, which rejects insufficiently supported claims such as god claims.

If you'd like to see the effect of throwing gods into your inquiries about physical reality, look to the ID people and the lack of benefit that move had for them. Throwing a god into abiogenesis research would be just as unhelpful.

What value would it be to do that here? None.



No, it hasn't been abandoned. If it were, abiogenesis research would be abandoned.

Astrology has been abandoned.

I frequently ask creationist this question,and seldom get an answer, and never a good one: What do you propose that the scientists do? Just quit looking for the answers and accept a creationist position? Yes or no should appear somewhere in your answer.

I hear you loud and clear. As to your last question, it's great!

What if scientists employed both creation and mechanistic evolution as they explore their hypotheses? The third alternative website says, "Evolution has problems inherent but we reject a creator, too," and how is that scientific? I thought scientists go where the truth leads if they're impartial? Why ignore a hypothesis with tremendous explanatory power when much of modern evolutionary biology is exactly that, storytelling?

 

[Thermos aquaticus]

I call baloney.

How do you calculate the probability of an object forming through natural mechanisms if you don't even know what that object is?

 

[Thermos aquaticus]

"We see"? Which present tense change might I be observing today, please?

The 50 to 100 mutations that each and every person is born with.

Do you have any comment on the math? Do you disagree that only a tiny, tiny fraction of the mutations that did occur in the human lineage have to be kept in order to produce the differences we see between humans and chimps?

 

[Thermos aquaticus]

Someone hasn't heard of Fermi's Paradox.

You haven't heard of math.

 

[It Aint Necessarily So]

Someone hasn't heard of Fermi's Paradox.

Fermi's paradox doesn't address the problem of extraterrestrial life, but of intelligent extraterrestrial life capable of vising us or communicating with us. We're not expecting to hear from creatures unicellular creatures out there, or from multicellular life no more advanced than to our plants, insects,or worms.

I hear you loud and clear. As to your last question, it's great!

Thanks. Then perhaps you'd like to answer it. Here it comes again: "I frequently ask creationist this question,and seldom get an answer, and never a good one: What do you propose that the scientists do? Just quit looking for the answers and accept a creationist position? Yes or no should appear somewhere in your answer."

How about a yes or no this time.

What if scientists employed both creation and mechanistic evolution as they explore their hypotheses?

Where would you insert creationism into science? Where would you stick it into Darwin's theory? The Lord said let there be natural selection?

I thought scientists go where the truth leads if they're impartial?

Scientists observe then explain. No observation leads to a god, so scientists don't go there.

Why ignore a hypothesis with tremendous explanatory power when much of modern evolutionary biology is exactly that, storytelling?

Creationism has no explanatory power. It's merely the unsupported claim that God did it. An explanation requires a mechanism.

Darwin's theory explains the advent of the tree of life from a single ancient ancestral population through natural selection acting on genetic variation - the mechanism of biological evolution. That's very different from just saying that God did it.

 

[BilliardsBall]

How do you calculate the probability of an object forming through natural mechanisms if you don't even know what that object is?

Because logic dictates that to go from replicator to the simplest imaginable cell, there are immense probabilities in play. IMMENSE.

 

[BilliardsBall]

The 50 to 100 mutations that each and every person is born with.

Do you have any comment on the math? Do you disagree that only a tiny, tiny fraction of the mutations that did occur in the human lineage have to be kept in order to produce the differences we see between humans and chimps?

Respectfully, I disagree, as saying we are 98% chimp, which we are less, is not "a few genetic differences". How many would you say 2% is?

 

[BilliardsBall]

Fermi's paradox doesn't address the problem of extraterrestrial life, but of intelligent extraterrestrial life capable of vising us or communicating with us. We're not expecting to hear from creatures unicellular creatures out there, or from multicellular life no more advanced than to our plants, insects,or worms.



Thanks. Then perhaps you'd like to answer it. Here it comes again: "I frequently ask creationist this question,and seldom get an answer, and never a good one: What do you propose that the scientists do? Just quit looking for the answers and accept a creationist position? Yes or no should appear somewhere in your answer."

How about a yes or no this time.



Where would you insert creationism into science? Where would you stick it into Darwin's theory? The Lord said let there be natural selection?



Scientists observe then explain. No observation leads to a god, so scientists don't go there.



Creationism has no explanatory power. It's merely the unsupported claim that God did it. An explanation requires a mechanism.

Darwin's theory explains the advent of the tree of life from a single ancient ancestral population through natural selection acting on genetic variation - the mechanism of biological evolution. That's very different from just saying that God did it.

The answer is NO. A scientist can look from multiple perspectives, for example, space seed, meteor impact, abiogenesis and creation without FEAR. I respect scientists who hypothesize without the fear that is employed by scientism.

 

[Thermos aquaticus]

Because logic dictates that to go from replicator to the simplest imaginable cell, there are immense probabilities in play. IMMENSE.

How can you calculate those probabilities if you don't even know what the first replicator looked like?

 

[Thermos aquaticus]

Respectfully, I disagree, as saying we are 98% chimp, which we are less, is not "a few genetic differences". How many would you say 2% is?

Just a quick primer on comparing DNA so we can be on equal footing. There are many ways to describe differences between genomes, and all of them have their pros and cons. Let's use an example:

species A: ATGAGGTCCGATACCGATAATGGCCCC
species B: ATGAGCTCCG---CCGGTAATGGCCCC

In that comparison there are two substitution mutations and one 3 base indel (i.e. a gap where DNA was inserted in one species or deleted in the other). Overall, there are 27 bases and the two species differ by a total of 5 bases across that stretch. Scientists are also interested in the substitution mutation rate, so they like to compare DNA that the species still share. In this case, they ignore the indel and say that the two species have 22/24 identity within DNA that they share. They can also treat the indel as a single mutation (which it probably was since the chances of three 1 base indels occurring next to each other is highly unlikely) and say that the two sequences differ by 3 mutations out of 27 bases. These are all legitimate ways of describing the differences between two genomes as long as you specify which method you are using.

Getting back to the human-chimp comparison, the chimp genome paper describes it like this:

"Through comparison with the human genome, we have generated a largely complete catalogue of the genetic differences that have accumulated since the human and chimpanzee species diverged from our common ancestor, constituting approximately thirty-five million single-nucleotide changes, five million insertion/deletion events, and various chromosomal rearrangements."

"Single-nucleotide substitutions occur at a mean rate of 1.23% between copies of the human and chimpanzee genome, with 1.06% or less corresponding to fixed divergence between the species."

"Insertion and deletion (indel) events are fewer in number than single-nucleotide substitutions, but result in ∼1.5% of the euchromatic sequence in each species being lineage-specific."

 

[Subduction Zone]

Because logic dictates that to go from replicator to the simplest imaginable cell, there are immense probabilities in play. IMMENSE.

How so? You appear to be merely making an argument from ignorance. Talks to a biochemist that understands how proteins and other molecules fold. Creationists almost always use oversimplified processes in their "odds arguments". If you could clearly state one even I could probably find the flaw in it.

 

[It Aint Necessarily So]

I frequently ask creationist this question,and seldom get an answer, and never a good one: What do you propose that the scientists do? Just quit looking for the answers and accept a creationist position?

The answer is NO. A scientist can look from multiple perspectives, for example, space seed, meteor impact, abiogenesis and creation without FEAR. I respect scientists who hypothesize without the fear that is employed by scientism.

OK, but then why did you reproduce the opinion from Popa that seems to be an exhortation to give up? He wrote

• Life's origin has been most ardently pursued by chemists, apparently on the unspoken premise that once the molecular building blocks are on hand, cellular organization will take care of itself. That premise is surely incorrect. Modern cells do not assemble themselves from preformed constituents, and they would not have done so in the past.…the notion that the first protocells assembled themselves spontaneously from a generous menu of precursor molecules conveniently supplied by abiotic chemistry (or imported by way of comets and meteorites) is now widely recognized as simplistic and effectively has been abandoned."

Isn't he telling us that abiogenesis research is a dead end? He says that cells in the past could not have self-assembled. He falsely claims that the central thrust of abiogenesis research has been abandoned. So we can safely say that he would advise scientists doing this research to cease, since he sees no future in it. I assumed that you agreed, and that that was why you bought his opinion here.

You seem to not understand why God isn't in science. You see it as closed-mindedness, and an effort to squelch god beliefs. You've been told repeatedly why god doesn't figure into science, but refuse to hear or learn.

It's unreasonable to expect science to modify a centuries old program that has been brilliantly successful to accommodate religious beliefs. They're pretty happy with their present perspective.

Let's pretend for a moment that it is scientific to insert a god despite insufficient supporting evidence for one. Go ahead and insert one into any scientific theory or law you choose and see what it does for it. See if it gives any extra explanatory or predictive power.

It doesn't, meaning that even if there is a god behind all of this, sticking it into the theory does nothing for us.

 

[BilliardsBall]

How can you calculate those probabilities if you don't even know what the first replicator looked like?

I'm not pretending not to know via evolution storytelling! Go ahead and tell me how many functions that replicator had, but even if it's one function, replication, it was an immensely complex item!

 

[BilliardsBall]

How so? You appear to be merely making an argument from ignorance. Talks to a biochemist that understands how proteins and other molecules fold. Creationists almost always use oversimplified processes in their "odds arguments". If you could clearly state one even I could probably find the flaw in it.

Is it oversimplified to state emphatically your simple replicator... has never been replicated by science?