Another irrefutable proof that God created all things using mathematical induction. And a proof that The Bible is the word of God.

[Esteban X]

No, Santa is just "saint" in Italian and I believe Spanish too. It means "holy". But that is another problem of KJV only people. They think that English is the only language in the world at times.

It should go without saying that everybody, with the exception Saved By The Lord and Yours True, is aware that Santa Claus refers to Saint Nicholas who was an actual historical person. I don't know why I bother to mention this, as I said it goes without saying.

 

[Monty]

The magnetic north pole. That is why it is so hard to find him and it is sometimes shown to be on land. The dang thing keeps moving!!

I understand he lives near Rovaniemi on the Arctic Circle, and why they celebrate the earliest sunset and Mithra's birthday on 25th December there, and just after the winter solstice. rovaniemi santa - Bing

 

[SavedByTheLord]

It should go without saying that everybody, with the exception Saved By The Lord and Yours True, is aware that Santa Claus refers to Saint Nicholas who was an actual historical person. I don't know why I bother to mention this, as I said it goes without saying.

That is what many do believe, but Satan deceives the whole world.

Santa is not Saint Nicholas. It makes no sense.
Santa knows whether you are good or bad.
How does Saint Nicholas have that power?
Santa makes it around the whole world in 1 night.
How does Saint Nicholas have that power?
Santa is in very many places, malls, etc at once leading up to Christ-Mass.
How does Saint Nicholas have that power?
Santa and the reindeer fly.
How does Saint Nicholas have that power?
Santa is assumed to never lie and to never sin.
Is that Saint Nicolas?

There are a number of other things about Santa that match either God the Father or Jesus Christ.
Satan said he would be like the Most High.
BTW, why do all these adults lie to children about Santa?
Isn’t Satan the father of lies?

And why on the day that Christ was supposedly born (He wasn’t) is Santa the most mentioned?

Satan (just move the n in Santa to the end) deceives the whole world.

 

[Monty]

And why on the day that Christ was supposedly born (He wasn’t) is Santa the most mentioned?

Satan (just move the n in Santa to the end) deceives the whole world.

So when was Jesus born, and when was Santa born?

 

[Esteban X]

That is what many do believe, but Satan deceives the whole world.

Santa is not Saint Nicholas. It makes no sense.
Santa knows whether you are good or bad.
How does Saint Nicholas have that power?
Santa makes it around the whole world in 1 night.
How does Saint Nicholas have that power?
Santa is in very many places, malls, etc at once leading up to Christ-Mass.
How does Saint Nicholas have that power?
Santa and the reindeer fly.
How does Saint Nicholas have that power?
Santa is assumed to never lie and to never sin.
Is that Saint Nicolas?

There are a number of other things about Santa that match either God the Father or Jesus Christ.
Satan said he would be like the Most High.
BTW, why do all these adults lie to children about Santa?
Isn’t Satan the father of lies?

And why on the day that Christ was supposedly born (He wasn’t) is Santa the most mentioned?

Satan (just move the n in Santa to the end) deceives the whole world.

The myths that have accrued around the figure of Saint Nicholas are the same as those that have accrued about the figure of Jesus of Nazareth. Fanciful tales that no one takes seriously

 

[SavedByTheLord]

The myths that have accrued around the figure of Saint Nicholas are the same as those that have accrued about the figure of Jesus of Nazareth. Fanciful tales that no one takes seriously

Jesus Christ is an historic person.

Saint Nicholas is supposedly an historic person.
Santa is not an historical person.
Santa is just a lie,

 

[Monty]

Jesus Christ is an historic person.

Where is he buried?

 

[Subduction Zone]

Jesus Christ is an historic person.

Saint Nicholas is supposedly an historic person.
Santa is not an historical person.
Santa is just a lie,

Santa is magical historical Saint Nicholas, just as your version of Jesus was magical historical Jesus.

 

[SavedByTheLord]

Santa is magical historical Saint Nicholas, just as your version of Jesus was magical historical Jesus.

The Lord Jesus Christ is the most documented historical figure from ancient times.

A man, whose career is a homicide detective, also analyzed the 4 gospel accounts using the same techniques that investigators use with eye witness records and determined that they are true eye witness accounts even to the very words of Jesus Christ.

The author is Warner Wallace. He did this starting as an atheist.

The book is Cold-Case Christianity: A Homicide Detective Investigates the Claims of the Gospels.

Lee Strobel was a an investigative reporter and tried to disprove the Bible and Jesus Christ. He was an atheist. He failed and become a believer.

His book is A Case for Christ.

 

[F1fan]

It should go without saying that everybody, with the exception Saved By The Lord and Yours True, is aware that Santa Claus refers to Saint Nicholas who was an actual historical person. I don't know why I bother to mention this, as I said it goes without saying.

And like many magical legends it is based on a real person doing mundne tasks that gets embellished over time to make the deeds seem more fantastic. Jesus is no doubt in this category of likely being a real person whose story was embellished into a fantastic story.

 

[F1fan]

The Lord Jesus Christ is the most documented historical figure from ancient times.

A man, whose career is a homicide detective, also analyzed the 4 gospel accounts using the same techniques that investigators use with eye witness records and determined that they are true eye witness accounts even to the very words of Jesus Christ.

The author is Warner Wallace. He did this starting as an atheist.

The book is Cold-Case Christianity: A Homicide Detective Investigates the Claims of the Gospels.

Lee Strobel was a an investigative reporter and tried to disprove the Bible and Jesus Christ. He was an atheist. He failed and become a believer.

His book is A Case for Christ.

Strobel's book was terrible. The major flaw is that the Gospels aren't factual or swworn testimony. They are hearsay at best, and it is not admissible in court. The case depends on assuming the Gospels are true, and no rational juror can't assume such a thing as true.

Funny story about Strobel, he was interviewed on the Hank Hanegraaf show and when asked how he became a Christians Lee admitted that his fiance threatened to break off their marriage unless he became a Christian. So he was essentially blackmailed into Christianity and marriage. Of course he jumped in with both feet, probably to convince his fiance he was sincere. Its easier to deceive others when you deceive yourself first.

 

[SavedByTheLord]

Strobel's book was terrible. The major flaw is that the Gospels aren't factual or swworn testimony. They are hearsay at best, and it is not admissible in court. The case depends on assuming the Gospels are true, and no rational juror can't assume such a thing as true.

Funny story about Strobel, he was interviewed on the Hank Hanegraaf show and when asked how he became a Christians Lee admitted that his fiance threatened to break off their marriage unless he became a Christian. So he was essentially blackmailed into Christianity and marriage. Of course he jumped in with both feet, probably to convince his fiance he was sincere. Its easier to deceive others when you deceive yourself first.

They are historical writings and have no errors and Warner Wallace proves that in his book also.

 

[F1fan]

They are historical writings and have no errors and Warner Wallace proves that in his book also.

They are part of history. That history includes texts that are highly embellished, so we can't take them literally, or as true at face value. All the supernatural bits can be dismissed given there being no evidence tht supernaturalism is real. Sorry. Try to think factually, not dogmatically. Reason, logic, and debate requires facts, not belief, not dogma, not assumptions. Your whole position relies on belief, dogma, and assumptions, and critical thinkers know better.

 

[SavedByTheLord]

They are part of history. That history includes texts that are highly embellished, so we can't take them literally, or as true at face value. All the supernatural bits can be dismissed given there being no evidence tht supernaturalism is real. Sorry. Try to think factually, not dogmatically. Reason, logic, and debate requires facts, not belief, not dogma, not assumptions. Your whole position relies on belief, dogma, and assumptions, and critical thinkers know better.

So according to you there is "no evidence that supernaturalism is real" and so it is dismissed. That is just circular reasoning.

All living creatures prove God exists because abiogenesis is impossible.

What about the first living creature?
The smallest free-living creature has over 1.3 million base pairs.
Assume 100,000 base pairs for the first living creature, a mere 1/13 of that size.
The odds against that sequence is 8^200,000 to 1 (8 kinds of nucleotides counting handedness and 2 per pair).
That comes to more than 10^180,000 to 1.
Now the proteome would have at least as many aminos as nucleotides since the body of all creatures are really made of proteins.
The odds against all those sequences of amino acids is more than 39^200,000 to 1 or more than 10^320,000 to 1.
The combined odds against it are more than 10^500,000 to 1.
But this was so very generous. Where did all these nucleotides and aminos come from?
Now the total number of atoms in one base pair is 30 and in about 20 in the average amino acid.
So, the total number of atoms in such a first living creature would be greater than that, but that still comes to over 7 million atoms.
Now each atom must be in a certain 3D arrangement with certain elements at each spot. Assume just 100 possibilities per atom.
The odds against that are over 100^7 million to 1 or greater than 10^14 million to 1.
The number of chances maybe 10^250 reduces those odds against to 10^13,999,750 to 1.
That is just absurd.

 

[ratiocinator]

All living creatures prove God exists because abiogenesis is impossible.

False. Your assumptions have been shown to be baseless.

The smallest free-living creature has over 1.3 million base pairs.

Unargued assertion. All that follows is pointless, baseless bluster. You refuse to engage with those who have shown you why all this is wrong. You just run away again and again, like you're terrified that you might be wrong....

 

[SavedByTheLord]

False. Your assumptions have been shown to be baseless.


Unargued assertion. All that follows is pointless, baseless bluster. You refuse to engage with those who have shown you why all this is wrong. You just run away again and again, like you're terrified that you might be wrong....

Yes it is pointless to refute that evidence against evolution and billions of years.

The smallest free-living creature has over 1.3 million base pairs.
Assume 100,000 base pairs for the first living creature, a mere 1/13 of that size.
The odds against that sequence is 8^200,000 to 1 (8 kinds of nucleotides counting handedness and 2 per pair).
That comes to more than 10^180,000 to 1.
Now the proteome would have at least as many aminos as nucleotides since the body of all creatures are really made of proteins.
The odds against all those sequences of amino acids is more than 39^200,000 to 1 or more than 10^320,000 to 1.
The combined odds against it are more than 10^500,000 to 1.
But this was so very generous. Where did all these nucleotides and aminos come from?
Now the total number of atoms in one base pair is 30 and in about 20 in the average amino acid.
So, the total number of atoms in such a first living creature would be greater than that, but that still comes to over 7 million atoms.
Now each atom must be in a certain 3D arrangement with certain elements at each spot. Assume just 100 possibilities per atom.
The odds against that are over 100^7 million to 1 or greater than 10^14 million to 1.
The number of chances maybe 10^250 reduces those odds against to 10^13,999,750 to 1.
That is just absurd.

If it just 50,000 base pairs it is still absurd.
I can work out the calculations for that.

 

[F1fan]

So according to you there is "no evidence that supernaturalism is real" and so it is dismissed.

Correct. Not even you believers can demonstrate a supernatural exists, so it is irrelevant.

All living creatures prove God exists because abiogenesis is impossible.

False. Abiogenesis is consistent with how nature works and is likely how the building blocks of life formed. Supernatural claims are not consistent with facts and nature, so irrelevant.

What about the first living creature?
The smallest free-living creature has over 1.3 million base pairs.
Assume 100,000 base pairs for the first living creature, a mere 1/13 of that size.
The odds against that sequence is 8^200,000 to 1 (8 kinds of nucleotides counting handedness and 2 per pair).
That comes to more than 10^180,000 to 1.
Now the proteome would have at least as many aminos as nucleotides since the body of all creatures are really made of proteins.
The odds against all those sequences of amino acids is more than 39^200,000 to 1 or more than 10^320,000 to 1.
The combined odds against it are more than 10^500,000 to 1.
But this was so very generous. Where did all these nucleotides and aminos come from?
Now the total number of atoms in one base pair is 30 and in about 20 in the average amino acid.
So, the total number of atoms in such a first living creature would be greater than that, but that still comes to over 7 million atoms.
Now each atom must be in a certain 3D arrangement with certain elements at each spot. Assume just 100 possibilities per atom.
The odds against that are over 100^7 million to 1 or greater than 10^14 million to 1.
The number of chances maybe 10^250 reduces those odds against to 10^13,999,750 to 1.

Show us experts that back you up. Otherwise we dismiss your opinion.

 

[ratiocinator]

Yes it is pointless to refute that evidence against evolution and billions of years.

There is none. Every claim you made has been refuted and all you do is run away.

The smallest free-living creature has over 1.3 million base pairs.
Assume 100,000 base pairs for the first living creature, a mere 1/13 of that size.
The odds against that sequence is 8^200,000 to 1 (8 kinds of nucleotides counting handedness and 2 per pair).
That comes to more than 10^180,000 to 1.
Now the proteome would have at least as many aminos as nucleotides since the body of all creatures are really made of proteins.
The odds against all those sequences of amino acids is more than 39^200,000 to 1 or more than 10^320,000 to 1.
The combined odds against it are more than 10^500,000 to 1.
But this was so very generous. Where did all these nucleotides and aminos come from?
Now the total number of atoms in one base pair is 30 and in about 20 in the average amino acid.
So, the total number of atoms in such a first living creature would be greater than that, but that still comes to over 7 million atoms.
Now each atom must be in a certain 3D arrangement with certain elements at each spot. Assume just 100 possibilities per atom.
The odds against that are over 100^7 million to 1 or greater than 10^14 million to 1.
The number of chances maybe 10^250 reduces those odds against to 10^13,999,750 to 1.
That is just absurd.

If it just 50,000 base pairs it is still absurd.
I can work out the calculations for that.

Just repeating your baseless, unargued assertions, is just another way to run away.

You never have had the courage to address the fact that this small RNA molecule can reproduce:

NNNNNNUGCUCGAUUGGUAACAGUUUGAAUGGGUUGAAGUAU–GAGACCGNNNNNN ('N' means that it doesn't matter)

From: Creation: The Origin of Life / The Future of Life by Adam Rutherford. Called "R3C". More detail here: Evolution in an RNA World.

 

[SavedByTheLord]

There is none. Every claim you made has been refuted and all you do is run away.


Just repeating your baseless, unargued assertions, is just another way to run away.

You never have had the courage to address the fact that this small RNA molecule can reproduce:

NNNNNNUGCUCGAUUGGUAACAGUUUGAAUGGGUUGAAGUAU–GAGACCGNNNNNN ('N' means that it doesn't matter)

From: Creation: The Origin of Life / The Future of Life by Adam Rutherford. Called "R3C". More detail here: Evolution in an RNA World.

An RNA molecule can reproduce without a living creature?

Here is a reproducing RNA molecule.

C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C

Here is another reproducing RNA molecule.


A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A

Here is a hypothetical RNA sequence.

CAUGGAUCGAGACACGUUUAUGCCGCAUGUACAC

 

[Esteban X]

The odds against that are over 100^7 million to 1 or greater than 10^14 million to 1.
The number of chances maybe 10^250 reduces those odds against to 10^13,999,750 to 1.

Unlikely but not impossible and within infinity and eternity inevitable.