Huge gap between humans and animals

[tas8831]

Mutation needed to get the variation in the first place.

Are you missing our explanation of sexual variation?

I was not referring to sexual variation. I was responding to this:

"Of your 23 pairs of chromosomes, each pair is made up of one from each parent. A mix of both. You are a variation of your parents. No mutation needed."

Did you mean to quote someone else?

Newborns differ both from their parents and from each other, not from mutation, but from genomes formed by combining DNA from two parents.

It is not really "combining" their DNA. It is getting complementary chromosomes from each. And the differences in each parent are indeed derived via mutation, ultimately.

 

[tas8831]

oh yes I did

Convincing .....

He wrote:

"There is a huge difference between different animals and between animals and plants."

Yeah, I don't think you did.

 

[tas8831]

When you mix two different things together at roughly 50/50 you get variation. Interracial breeding is a good example.

Interracial breeding is an interesting refutation to the 'no mutation' notion, for how are there different races at all if there is no mutation, just a 'mixing of DNA' (whatever that is supposed to mean) from a single breeding pair (who were themselves virtually identical) in the Christian creation story?

 

[Thief]

Convincing .....

He wrote:

"There is a huge difference between different animals and between animals and plants."

Yeah, I don't think you did.

did you note the op title?

 

[tas8831]

Mix any two different things and you get variation. You are nothing more than a chemical mixture.

Sodium and chlorine gives you salt. Nothing to do with mutations.

Hydrogen and oxygen gives you water. Nothing to do with mutations.

Red and yellow make orange.

This is not how DNA works.

Sorry.

Nothing to do with mutations.

Then please explain FGFR3-related achondroplasia.

FGFR3 gene

 

[tas8831]

did you note the op title?

Yes, I did. A mere assertion.
You do not seem able to understand that the comparison was between the differences between animals on the one hand, and between plants and animals, on the other.

Not that hard to see, especially in light of the fact that humans ARE animals.

 

[Thief]

Yes, I did. A mere assertion.
You do not seem able to understand that the comparison was between the differences between animals on the one hand, and between plants and animals, on the other.

Not that hard to see, especially in light of the fact that humans ARE animals.

and there is a huge difference between humans and animals

 

[tas8831]

DNA is our chemical structure.

Not even close.

DNA is a polynucleotide molecule found in the nucleus of our cells.

Mix any two together and you change the structure.

Mix any two what?

Any 2 DNA? That makes no sense.

When sperm and egg combine to form a zygote, the DNA in the chromosomes does not 'mix' together - you really think that is what happens?

You call it mutations when its nothing but a variation from the original. Its the result of mixing two different DNA's.

No, it isn't.

Mutations are alterations in the sequence of one molecule of DNA. Here is an example:

original DNA sequence:
ATGTGCTGAAACGTGACTAG


DNA sequence after replication error produces mutation:
ATGTGCTAAAACGTGACTAG

No 'mixing'. Mutation.

Mixing two of anything gives variation. You are a mixture of your parents. You are a variation of what your parents are due to the mixture of their DNA. No mutations needed.

Salt isn't a mutation of sodium and chlorine, its a mixture of both chemicals. No mutation needed.

This makes zero sense. Salt is not made of a sequence of millions of sodiums.

Please - to avoid further embarrassment, visit this site and learn the basics:

Understanding Genetics: A New York, Mid-Atlantic Guide for Patients and Health Professionals.
GENETICS 101 - Understanding Genetics - NCBI Bookshelf

 

[tas8831]

and there is a huge difference between humans and animals

And there is a huge difference between any two animals.

The OP of this thread listed several laughable "examples" ("...thinking, talking and the ability to invent...").

What of it?

 

[ecco]

How equal, chickens are living to be slaughtered, millions of chickens are killed
in daily basis, no future and no gaol other than being a source for egg and meat.

Didn't your God give man dominion over animals to do with as he chose?

King James Bible
And God said, Let us make man in our image, after our likeness: and let them have dominion over the fish of the sea, and over the fowl of the air, and over the cattle, and over all the earth, and over every creeping thing that creepeth upon the earth.​

 

[Valjean]

I cannot believe you would even say such a ridiculous statement. Chickens are slaughtered by human because they are contained on farm just for that purpose. The chickens in the wild would disagree with you. It is like saying if you have human slaves that you think you own and they do all of the work for you then they have no future and no goal other than to serve the one who says they own them. Then again maybe you do not have a problem with that. Humans do many cruel things to animals and humans. That does not lessen the animal or human just because it can be mistreated or dominated by humans.

I don't see your point. I'm not saying captivity lessens chickens, in any moral sense.
Yes, chickens are bred on farms for slaughter. It's a purpose we assigned them, just as we once bred Africans on farms and assigned them a purpose. It's exploitation, either way, and we do it because we're able to -- Might-makes-right.

"It is like saying if you have human slaves that you think you own and they do all of the work for you then they have no future and no goal other than to serve the one who says they own them."

Yes, that pretty much sums it up. How is this different from chickens?

 

[Valjean]

Interracial breeding is an interesting refutation to the 'no mutation' notion, for how are there different races at all if there is no mutation, just a 'mixing of DNA' (whatever that is supposed to mean) from a single breeding pair (who were themselves virtually identical) in the Christian creation story?

You don't need mutations in individuals to get different races, just natural selection of naturally variant progeny, over time. New races didn't pop into existence from single mutations, like birth defects.

 

[tas8831]

You don't need mutations in individuals to get different races, just natural selection of naturally variant progeny, over time. New races didn't pop into existence from single mutations, like birth defects.

You need mutations to get the alleles that allow for altered phenotypes.

I never indicated anything about a new race arising from a single mutation.

 

[Thief]

You need mutations to get the alleles that allow for altered phenotypes.

I never indicated anything about a new race arising from a single mutation.

Adam and Eve

 

[FearGod]

I cannot believe you would even say such a ridiculous statement. Chickens are slaughtered by human because they are contained on farm just for that purpose. The chickens in the wild would disagree with you. It is like saying if you have human slaves that you think you own and they do all of the work for you then they have no future and no goal other than to serve the one who says they own them. Then again maybe you do not have a problem with that. Humans do many cruel things to animals and humans. That does not lessen the animal or human just because it can be mistreated or dominated by humans.

Do chickens in the wild have goals and thinking of the future?
Slaves are a different issue, there're many whores selling their bodies for money
and that's the only goal of their life, but that doesn't mean that I despised them as
they're working hard to live.

 

[tas8831]

You need mutations to get the alleles that allow for altered phenotypes.

I never indicated anything about a new race arising from a single mutation.

Adam and Eve

I'm sorry, what about them?

 

[Thief]

I'm sorry, what about them?

a divergence from the species created on Day Six

seriously separating Man from the rest of life on this planet

 

[FearGod]

Till this page no one had offered a scientific explanation as of why humans are the only creature on earth that lives and thinks differently than all other creatures on earth.

some said the blue whales are so huge and hence they're different than all other animals,
some others said all animals are unique and they have some intelligence.

You're the losers, and those who listen to you are the losers, good luck.

 

[tas8831]

a divergence from the species created on Day Six

seriously separating Man from the rest of life on this planet

When you present evidence that the creation week really happened, I will consider your cryptic chatter. But just writing "Adam and Eve" and expecting me to understand what your point is (I still don't see it) is not working..

 

[Valjean]

You need mutations to get the alleles that allow for altered phenotypes.

I never indicated anything about a new race arising from a single mutation.

Two dogs have six puppies. Each is different. The differences are not from mutations.
Natural selection works with these non mutational differences